SERBA-SERBI PEMERIKSAAN GENETIK

(BAGIAN 1)

 

Narasumber: Widya Eka Nugraha, M.Si. Med.

Konselor Genetik Indonesia Rare Disorders

RS Medika Dramaga Bogor

 

OUTLINE:

BAGIAN 1

  1. Dasar teori pemeriksaan genetik
  2. Macam-macam pemeriksaan genetik

BAGIAN 2

  1. Indikasi pemeriksaan genetik
  2. Peran konselor genetik

 

DASAR TEORI PEMERIKSAAN GENETIK

Kata genetik merujuk pada hal-hal yang berkaitan dengan materi dasar hereditas (pewaris sifat). Mengapa wajah saya mirip Ayah? Ibu? Kakek? Nenek? Benedict Cumberbatch?

Materi dasar hereditas tersebut kita kenal dengan sebutan DNA (Deoxyribose Nucleic Acid). DNA adalah molekul pembentuk gen yang terdiri dari 4 macam: Adenin, Thymidine, Cytosin, Guanin (disimbolkan sebagai A, T, C, G).

Kombinasi dari 4 molekul inilah yang akan membentuk gen. Jadi, ketika berbicara soal gen, sebenarnya kita berbicara tentang kode yang tersusun dari 4 huruf…

…ATTCGAGCGCGCTTACGGGTGAAACGTTGAACCGTA…

Itu berarti, yang disebut pemeriksaan atau tes genetik adalah menyelidiki apakah ada sesuatu yang salah dengan susunan kode tersebut.

Contoh:

Normal: ATTCGAGCGCGCTT ACGGGTGAA ACGTTGAACCGTA

Delesi: ATTCGAGCGCGCTTACGTTGAACCGTA

 

Normal: ATTCGAGCGCGCTT ACGGGTGAA ACGTTGAACCGTA

Duplikasi: ATTCGAGCGCGCTT ACGGGTGAA ACGGGTGAA ACGTTGAACCGTA

 

Normal: ATTCGAGCGCGCTT ACGGGTGAA ACGTTGAACCGTA

Translokasi: ATTCGAGCGCGCTTACGTTGAACCGTA ACGGGTGAA

 

Normal: GCAG A TCCT

Noonan syndrome: GCAG C TCCT

 

Mungkin terdengar sederhana, tetapi coba bayangkan fakta-fakta berikut:

  1. Sel tubuh manusia memiliki 3 miliar molekul DNA.

Rata2 satu baris percakapan WA pada tab seukuran 8 inchi sanggup memuat sampai 90 karakter. Artinya, jika saya kirimkan kode genetik anda via WA, maka butuh 33 juta baris WA!

  1. Basepairs adalah satuan panjang DNA.

Satu huruf yang mewakili jenis molekul DNA (A,T,C,G) disebut 1 basepair (bp). Jadi, jumlah total molekul DNA dalam 1 sel tubuh kita adalah 3 miliar bp. Semuanya dimampatkan ke dalam 23 pasang kromosom.

  1. Tidak semua DNA membentuk gen.

Sel tubuh manusia memiliki sekitar 20.000 gen dengan panjang rata-rata sekitar 3000 bp. Artinya, hanya 2% dari total DNA kita yang merupakan gen. Sedangkan 98% sisanya bukan merupakan gen. Gen-gen ini lokasinya tersebar di seantero kromosom 1 sampai kromosom 22 serta kromosom sex (X dan Y).

  1. Susunan kode gen antara satu orang dengan orang lainnya berbeda-beda.

Inilah yang disebut dengan variasi genetik. Ada dua jenis variasi genetik: varian normal dan mutasi genetik. Varian normal menyebabkan wajah, golongan darah, warna kulit, jenis rambut kita berbeda-beda. Sedangkan mutasi genetik adalah penyebab paling umum dari rare genetic disorder.

Dengan dasar teori inilah seorang ahli genetika menyelidiki penyebab dari suatu gangguan genetik. Dengan skala yang demikian masif, rasa-rasanya mirip seperti mencari jarum dalam tumpukan jerami.

 

MACAM-MACAM PEMERIKSAAN GENETIK

Berdasarkan ukuran basepair, kita bisa membagi pemeriksaan genetik menjadi dua, yaitu:

  1. Pemeriksaan Sitogenetika

Pemeriksaan sitogenetika dilakukan pada seseorang yang diduga mengalami kelainan kromosom (chromosomal rearrangement). Pemeriksaan ini dilakukan dengan mengambil sampel berupa sel (biasanya sel darah putih) untuk kemudian dilihat di bawah mikroskop.

Keuntungan dari prosedur ini adalah mudah, biaya tidak terlalu tinggi, dan reliable. Tetapi, pemeriksaan ini sulit dilakukan apabila mutasi genetik yang terjadi berukuran kurang dari 4 juta bp.

Beberapa diagnosis yang mungkin dapat diperiksa dengan menggunakan metode ini antara lain:

  1. Deletion Syndrome
  2. Duplication Syndrome
  3. Robertsonian Translocation Down Syndrome
  4. Philadelphia Chromosome (Leukemia)
  5. Patau Syndrome
  6. Edward Syndrome
  7. Trisomy Syndrome Lain
  8. Turner Syndrome
  9. Klinefelter Syndrome

Dan lain-lain

 

  1. Analisis Molekuler

Mutasi genetik berukuran kecil umumnya tidak terlihat lewat pemeriksaan sitogenetik biasa. Itu sebabnya analisis molekuler dilakukan untuk menyelidiki mutasi genetik yang berukuran kecil atau kurang dari 4 juta bp.

Pemeriksaan ini bisa membantu pada kasus-kasus:

  1. Apert Syndrome
  2. Becker Muscular Dystrophy
  3. Congenital Adrenal Hyperplasia
  4. Cornelia De Lange Syndrome
  5. Duchenne Muscular Dystrophy
  6. Joubert Syndrome
  7. Noonan Syndrome
  8. Spinal Muscular Atrophy

Dan seterusnya…

Ada banyak jenis analisis molekuler, mulai dari PCR, MLPA, SNP-array, sampai dengan sequencing. Tujuan dari semua pemeriksaan tersebut sama: menyelidiki di mana letak mutasi susunan kode gen pada orang dengan kondisi langka.

Dengan berbekal data klinis dan hasil dari pemeriksaan genetik, maka tim dokter dari seseorang dengan kondisi genetik langka dapat memberikan penanganan yang menyeluruh.

———————————————————————————

Q :   Untuk kasus anak saya apa perlu juga pemeriksaan genetik ini dokter, dan untuk di Jawa Timur bisa di RS mana?Apakah dicover BPJS? Juga gimana caranya menentukan ukuran basepair nya dok?

A  :    Mohon maaf, mungkin boleh dijelaskan sedikit mengenai kasus anak Ibu? Untuk masalah BPJS, sebenarnya agak ‘tricky‘. Sedangkan untuk menentukan ukuran basepair yang mengalami kerusakan bisa diperkirakan dengan 2 cara, yaitu:

  1. Pemeriksaan Fisik

Jika dari pemeriksaan fisik kita menjumpai sesuatu yang secara khas merupakan kelainan kromosom (terkadang disebut chromosomal face), maka diperkirakan basepair yang mengalami delesi cukup besar untuk dapat terlihat lewat pemeriksaan kromosom.

  1. Pemeriksaan Microarray atau Sequencing

Apabila dari pemeriksaan fisik tidak mendukung ke arah kelainan kromosom, maka sebaiknya dilakukan pemeriksaan microarray atau sequencing. Dari situ kita bisa mengetahui ukuran basepair yang mengalami kerusakan.

*****

 

Q :   Dok, saya sampai saat ini baru sebatas melakukan tes kromosom terhadap anak saya. Hasilnya yaitu Trisomy 21, Monosomy 22 dimana pasangannya translokasi ke kromosom 7 tapi tidak membuat kromosom 7nya menjadi Trisomy karena si kromosom 22 yang pindah, hanya menempel di ekor kromosom 7. Hanya penjelasan itu yang saya dapatkan saat mendapat hasil tes kromosom anak saya tahun 2012. Dan saya sempat menemui seorang Profesor di daerah Jakarta, tapi beliau juga belum bisa menyebutkan syndrome apakah nama kelainan genetik anak saya. Kamu hanya bisa fokus pada Down Syndromenya saja tapi dengan kelainan juga karena wajahnya tidak khas Down Syndrome. Jadi beliau hanya mengarahkan saya untuk fokus pada tumbuh kembangnya saja agar optimal. Pertanyaan saya, apakah sekarang sudah ada kasus yang serupa seperti anak saya dan apa namanya? Lalu perlukah saya melakukan pemeriksaan ulang? Kebetulan hasil tesnya terselip entah dimana. Saya coba cari tapi belum ketemu juga. Terima kasih.

A  :    Saya belum tahu. Mungkin ada mungkin juga belum. Tidak perlu dilakukan pemeriksaan ulang pada anak. Cobalah untuk meminta hasil pemeriksaan sebelumnya di tempat tes tersebut dilakukan. Apakah orang tuanya sudah dilakukan pemeriksaan kromosom?

*****

 

Q :   Dok, genetik kan turunan. Adakah cara agar tak terulang untuk kasus Congenital Adrenal Hiperplasia?

A  :    Penting untuk diketahui bahwa tidak semua genetic disorder diturunkan. Ada banyak genetic disorder yang terjadi begitu saja (istilahnya de novo).

Sayangnya, untuk kasus CAH umumnya diturunkan secara autosomal resesif. Sehingga, pertanyaan Ibu hanya bisa dijawab lewat proses konseling genetika yang komprehensif.

Dalam proses konseling genetika terdapat:

  1. Assessmen menyeluruh mengenai kondisi genetik dalam satu keluarga.
  2. Pembuatan pohon keluarga.
  3. Menghitung risiko penurunan suatu kondisi genetik terhadap generasi berikutnya.
  4. Langkah-langkah antisipatif yang bisa diambil.

Semoga membantu.

*****

 

Q :   Kemungkinannya berapa persen ya dok untuk kasus kelainan genetik terulang lagi? Anak ini kasus pertama mutasi gen. Berencana hamil lagi tapi rasa khawatir masih terus membayangi.

A  :    Pertanyaan ini hanya bisa terjawab melalui proses konseling genetika.

Q :   Proses Konseling genetika ini ditanyakannya ke dokter apa ya dok?

A  :    Proses konseling genetika dilaiukan bersama seorang konselor genetik.

Q :   Apakah di RSCM bisa dilakukan konseling genetika?

A  :    Harusnya di RSCM atau RSIA Harapan Kita bisa ya.

*****

 

Q :   Anak saya dulu pernah test kromosom di salah satu RS di daerah Bekasi, tapi tidak dikasi copy hasilnya, hanya diberitahu baik-baik saja (kalau tidak salah dengar, karena DSA-nya fokus ke virusnya, lupa juga dulu virus apa). Jadi kami hanya fokus ke kelainan-kelainan yang terlihat saja. Baru-baru ini dokter endokrinnya menyuruh untuk test kromosom lagi, hanya kata DSA, sebaiknya fokus ke masalah yang ada aja, test kromosom itu hanya untuk nice to know aja, karena tidak ada yg bisa dilakukan juga setelah tahu hasilnya. Jadi, seberapa penting test kromosom dilakukan? Untuk kasus anak saya, apakah perlu? Makasih

A  :    Untuk mengetahui apakah kasus anak Ibu perlu dilakukan pemeriksaan kromosom atau tidak, seorang dokter HARUS memeriksanya terlebih dahulu.

Setelah diperiksa, apabila dirasa perlu, maka sebaiknya pemeriksaan kromosom tetap dilakukan. Kalau sudah ada, sebaiknya diminta hasilnya. Kalau tidak boleh, coba difoto/dicatat saja.

Apa yang bisa dilakukan setelah mengetahui hasil tesnya? Jika hasilnya baik, kita bisa bersyukur kepada Tuhan YME. Jika hasilnya terdapat genetic disorder, kita bisa bersyukur dan melakukan proses konseling genetika.

*****

 

Q :   Mohon pencerahan ya, dok. Sayangnya anak saya belum cek kromosom, jadi belum bisa tanya banyak di kulwap ini. Kasus anak saya adalah tidak punya lubang vagina, namun bentuk alat kelamin adalah alat kelamin perempuan, jadi masalahnya bukan ambiguitas genitalia tapi tidak ada lubang vagina. Pemeriksaan yang sudah dilakukan baru pmeriksaan fisik dan konselor, memang ada PR untuk cek kromosom agar lebih memastikan lagi, eventhough konsulen bilang “Kalau saya lihat dari bentuk alat kelaminnya sih sepertinya kok normal kromosomnya, tp dicek saja untuk memastikan”.

A  :    Salah satu indikasi absolut pemeriksaan kromosom adalah pada kasus-kasus dengan kerancuan jenis kelamin atau ambiguous genitalia. Sejujurnya saya kurang paham dengan ‘tidak punya lubang vagina’ tetapi bentuk alat kelamin adalah alat kelamin perempuan.

*****

 

Q :   Ada yang tahu info kalau imunisasi dicover BPJS?

A  :    Tergantung jenis imunisasinya, Mbak.

*****

 

Q :   Tanya ya. Anak-anakku kelainannya segmen q12-q21 di kromosom 6 duplikasi dan sisip di kromosom 15 diantara segmen q14 dan q15. Pertanyaanya, yang lebih memberi impact pada, katakanlah tumbuh kembangnya itu pada duplikasinya, atau pada kromosom 15 yang terpotong? Kan jadinya ada yang lompat, begitu urutannya. Yang harusnya q14 terus q15, tapi ini jadi terpotong q14,(segmen yg diplikasi), baru q15.

A  :    Kemungkinan besar gangguan tumbuh-kembang terjadi karena duplikasinya. Untuk translokasi tidak selalu memberikan pengaruh yang signifikan pada kondisi klinis. Namun demikian, translokasi tertentu dapat menyebabkan timbulnya keganasan (kanker).

*****

 

Q :   Kalau saya ingin tahu apa penyebab mutasi genetic de novo. Apakah karena pengaruh makanan, chemical, radiasi atau apa? Adakah cara untuk mencegahnya?

A  :    Sampai saat ini kita belum tahu pasti. Semuanya masih mungkin-mungkin saja, tetapi tidak ada bukti yang jelas. Tidak ada cara untuk mencegahnya.

*****

 

Q :   Penyebab mutasi gen itu apa ya, dok? Dan adakah cara mencegahnya?

A  :    Sampai saat ini kita belum tahu pasti. Semuanya masih mungkin-mungkin saja, tetapi tidak ada bukti yang jelas. Tidak ada cara untuk mencegahnya.

*****

 

Q :   Kode-kode itu apakah ada kamus artinya/pengaruhnya? Bisakah kita tahu, misal kalau yang bermasalah q12-q21, apa saja yang akan bermasalah di tubuh kita?

A  :    Kode-kode tersebut merupakan nomenklatur internasional untuk kelainan kromosom. Segmentasi kromosom bisa digunakan sebagai panduan untuk mengetahui gen-gen apa saja yang terlibat, serta efeknya terhadap kondisi medis anak.

*****

 

Q :   Perlukah saya dan suami juga melakukan tes kromosom, dok? Tujuannya apa?

A  :    Tanpa bosan-bosan akan saya ulangi. Ini adalah pertanyaan yang hanya bisa dijawab lewat konseling genetika. Saya harus tahu dulu bagaimana kondisi anak ibu, membaca hasil karyogram-nya, baru kemudian bisa membantu untuk menjawab pertanyaan ini.

Q :    Karyogram itu apa, dok? Dan kemana saya harus konsultasi?

A  :   

*****

 

Q :   Dok, maaf. Ini saya sambil browsing tentang monosomy 22, yang kemudian mengarahkan saya pada salah satu kelainan yang terjadi akibat kromosom 22, namanya Ewing Sarcoma Syndrome yang berkaitan dengan sel kanker. Ini sumbernya dari Wikipedia dan di bagian causesnya ada yang menyebutkan seperti ini : Other translocations are at t(21;22)[8] and t(7;22).[9]. Di nomor 9 itu saya klik linknya, kemudian mengarah ke sini https://www.ncbi.nlm.nih.gov/pubmed/7700648, dan saya tidak mengerti penjelasannya, apakah memang terkait dengan kasus anak saya ataukah tidak. Siapa tahu nanti dokter ada waktu untuk membaca, tolong kasih tahu saya ya, dok. Maaf, saya bingung dengan istilah-istilahnya. Cuma lihat ada kromosom 7 dan kromosom 22 saja. Tentang Ewing Sarcoma Syndrome itu penjelasannya di wikipedia di link ini https://en.wikipedia.org/wiki/Ewing%27s_sarcoma. Terima kasih, Dok.

A  :    Seperti yang sudah saya sampaikan lewat jawaban untuk pertanyaan sebelumnya. Untuk translokasi tidak selalu memberikan pengaruh yang signifikan pada kondisi klinis. Namun demikian, translokasi tertentu dapat menyebabkan timbulnya keganasan (kanker). Salah satunya translokasi (7;22) yang menjadi predisposisi munculnya sarcoma Ewing.

*****

 

Q :   Apakah perlu tes genetika dan tes kromosom setiap anak yang mengalami keterlambatan perkembangannya, meskipun selama ini DSA tidak pernah menyarankan, sedangkan selama pengobatan belum ada hasil yang maksimal, hanya dengan pengobatan terus menerus serta fisioterapi?

A  : Perlukah? Saya akan jawab: tergantung. Apakah keterlambatan perkembangan itu disebabkan oleh genetik atau non-genetik? Tentunya, yang bisa menjawab pertanyaan ini hanya dokter yang memeriksa secara langsung. Menurut Ibu, seperti apakah hasil yang maksimal itu?

Q :   Belum ada hasil yg maksimal dilihat dari tidak ada kemajuan yang progresif untuk motoriknya. Masih seperti awal pengobatan. Apakah dengan pemeriksaan genetik dan kromosom kita bisa mengetahui solusi pengobatan keterlambatan tumbuh kembangnya ya dok? Terima kasih sebelumnya.

A  :    Pertanyaan bagus. Sayangnya seorang dokter harus periksa dulu baru bisa menjawab pertanyaan ini. Yang jelas, tidak semua keterlambatan tumbuh kembang disebabkan oleh genetik. Tapi, bila keterlambatan tersebut disertai dengan dismorfologi (kelainan pada bentuk wajah atau anggota tubuh yang lain), gangguan panca indera, organ dalam. Maka besar kemungkinan berasal dari genetik.

*****

 

Q :   Dok, mau tanya. Apakah perubahan kromosom bisa terjadi karena kedua orang tua memiliki golongan darah yang berbeda? Saya pernah dengar orang bilang ke saya, bila istri golongan darah O dan suami golongan darah B atau AB itu bisa berdampak pada janin? Terima kasih. Mohon pencerahannya.

A  :    Perubahan kromosom tidak terjadi karena perbedaan golongan darah pada orang tua. Tetapi, perbedaan golongan darah memang bisa menimbulkan jaundice (kuning) pada bayi baru lahir (bukan janin).

*****

 

Q :   Dok, anak saya kan diagnosanya Laryngeal Web dan Subglottic Stenosis. Dokter yg menanganinya tidak menyuruh kami untuk test kromosom. Tapi waktu kontrol ada dokter THT lain yang ikut melihat hasil laringskopi Byan, beliau celetuk ke kami untuk test chromosome 22q11 deletion. Karena katanya, biasanya anak dengan satu kelainan, pasti ada kelainan lainnya. Tapi sejauh ini yang saya lihat anak saya tidak ada gangguan lain selain nafasnya. Bentuk fisik pun normal. Perlukah saya test kromosom untuk anak saya? Kebetulan Januari lalu saya keguguran, dari hasil lab menyatakan janin saya tidak memiliki pembuluh darah dan tidak ada jantung. Haruskah saya dan suami test juga?

A  :    Sayangnya, saya hanya bisa menjawab lewat proses konseling genetika.

*****

 

Q :   Mau tanya, dok. Anak saya hasil lab kromosomnya adalah mosaic trisomy 22. Pada saat lahir, DSAnya curiga karena beliau bilang bentuk dahinya menyerupai burung Jerman. Sampai saat ini anak saya berumur 6 bulan, perkembangannya sesuai usianya. BB saat ini 10kg, makan tidak ada kendala, sudah belajar duduk, dalam arti motorik perkembangan sesuai dengan usianya. Pertanyaan saya, apakah ada tes lanjutan yang bisa mengetahui seberapa besar dampak dari mosaic trisomi 22 yg dialami anak saya?

A  :    Yang perlu dilakukan oleh orang tua sekarang adalah fokus pada tumbuh-kembang anak. Adapun untuk seberapa besar dampaknya memang tergantung berapa persentase sel yang mengalami trisomi. Apakah sudah diketahui?

Q :   Belum diketahui dok. Apakah ada tes lanjutan untuk mengetahui seberapa besar persentase sel yg mengalami trisomi? Jikalau ada, nama tesnya apa ya dok?

A  :    Nah, apakah hasil karyogramnya masih ada?

*****

 

 

Editor: KKP

4 thoughts on “Serba-Serbi Pemeriksaan Genetik (Bagian 1)

  1. Jikalau ada wanita umur 20 tahun dan baru menyadari ternyata memiliki kromosom xy, tidak haid dan tidak memiliki payudara itu pengobatannya gimana ya? Terimakash

  2. Jikalau ada wanita umur 20 tahun dan baru menyadari ternyata memiliki kromosom xy, tidak haid dan tidak memiliki payudara itu pengobatannya gimana ya? Terimakash

  3. Dok, saya belum pernah melakukan pemeriksaan genetik kira2 berapa besarannya? Jadi begini anak saya yang pertama didiagnosa CP ( skrg sudah almarhum) dia mengalami global development delay dan sampai di hari dia meninggal belum bisa apa2, awalnya saya kira mungkin dulu kena virus tapi sekarang saya punya anak laki lagi, gejala2 awalnya sama ya dok? Awalnya kejang tanpa demam, delay development, sekarang sering kaget2an dan muka mereka mirip banget, saya curiga ada kelainan dari genetik karena hasil darah saya semuanya bagus menurut spog yg dulu menangani kehamilan saya. Kira2 menurut dokter gimana ya? Dan kira2 anak saya kenapa dan apa pernah ada kasus spt anak saya?

Leave a Reply

Your email address will not be published. Required fields are marked *